MCP For Claude Marketplace
CRISPR Guide Designer

CRISPR Guide Designer MCP Connector for Claude

A+

Design optimal CRISPR guide RNAs by analyzing PAM sites, efficiency, and off-target risks.

4 tools Official Updated Oct 1, 2026 Official Vinkius Partner
More Details Connect to Claude

This MCP server provides a specialized toolset for CRISPR-Cas9 genome editing design. It allows AI agents to identify valid PAM sites using find_pam_sites, generate candidate sequences with design_grna_sequences, predict effectiveness via evaluate_on_target_efficiency, and mitigate unintended cleavage risks with assess_off_target_risk. It is designed to help researchers balance high on-target efficiency with minimal off-target effects.

crisprgenome-editingdnarnabiotech

4 tools expose this connector's capabilities to your AI agent.

evaluate_on_target_efficiency

Calculates the predicted effectiveness of specific guide sequences at their intended target

design_grna_sequences

Generates candidate guide RNA sequences based on identified target locations and PAM sites

find_pam_sites

g., "NGG"). Identifies all valid locations within a target gene where a PAM sequence exists to allow Cas9 binding

assess_off_target_risk

Predicts the danger of unintended cleavage by searching the genome for similar sequences

See how to talk to your AI agent using CRISPR Guide Designer.

Find all NGG PAM sites in the sequence ATGCGGATGCGG.

Found PAM sites at positions 4 and 10 with sequence NGG.

Design gRNA sequences for the target sequence GCTAGCTAGCTAGCTAGCTA with PAM sites at 5 and 15.

Generated 2 candidate guides: GCTAGCTAGCTAGCTAGCTAG (pos 5, score 0.85) and TAGCTAGCTAGCTAGCTAGC (pos 15, score 0.78).

What is the off-target risk for the guide sequence GCTAGCTAGCTAGCTAGCTA in the provided genome?

The risk profile shows 0 potential off-target sites with significant mismatch counts in the seed region.

You can use the `find_pam_sites` tool by providing the target DNA sequence and the required PAM motif, such as NGG.

Related Connectors

NEW
Pest Service Coordination Plan

Pest Service Coordination Plan MCP

4 tools Official

Coordinate pest inspections, compare service quotes, and prepare your home for visits.

A+ View details →
NEW
Chronic Pain Diary Analyzer

Chronic Pain Diary Analyzer MCP

4 tools Official

Identifies correlations between physiological, environmental, and activity data to manage chronic pain.

A+ View details →
NEW
Sleep Routine Automation Suggester

Sleep Routine Automation Suggester MCP

4 tools Official

Maps sleep habits and smart home hardware to customized automation sequences.

A+ View details →
NEW
Photo Library Deduplication Plan

Photo Library Deduplication Plan MCP

4 tools Official

Identify and resolve redundant photo records by analyzing technical metadata.

A+ View details →